ID: 920749257

View in Genome Browser
Species Human (GRCh38)
Location 1:208658556-208658578
Sequence GAGGACACAAGGTCTCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920749250_920749257 6 Left 920749250 1:208658527-208658549 CCTCAGGGTAAACCCATTGCCAG No data
Right 920749257 1:208658556-208658578 GAGGACACAAGGTCTCAACTTGG No data
920749253_920749257 -6 Left 920749253 1:208658539-208658561 CCCATTGCCAGTGACTGGAGGAC No data
Right 920749257 1:208658556-208658578 GAGGACACAAGGTCTCAACTTGG No data
920749254_920749257 -7 Left 920749254 1:208658540-208658562 CCATTGCCAGTGACTGGAGGACA No data
Right 920749257 1:208658556-208658578 GAGGACACAAGGTCTCAACTTGG No data
920749247_920749257 27 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749257 1:208658556-208658578 GAGGACACAAGGTCTCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920749257 Original CRISPR GAGGACACAAGGTCTCAACT TGG Intergenic
No off target data available for this crispr