ID: 920749978

View in Genome Browser
Species Human (GRCh38)
Location 1:208664741-208664763
Sequence ACATTATCTCAACTGCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920749975_920749978 8 Left 920749975 1:208664710-208664732 CCAAGAGACTGGCTTTTCACATG No data
Right 920749978 1:208664741-208664763 ACATTATCTCAACTGCCTTTTGG No data
920749974_920749978 9 Left 920749974 1:208664709-208664731 CCCAAGAGACTGGCTTTTCACAT No data
Right 920749978 1:208664741-208664763 ACATTATCTCAACTGCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920749978 Original CRISPR ACATTATCTCAACTGCCTTT TGG Intergenic