ID: 920751330

View in Genome Browser
Species Human (GRCh38)
Location 1:208680220-208680242
Sequence TCATCCTGCGGAGCTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920751330_920751334 -4 Left 920751330 1:208680220-208680242 CCTGGGCAAGCTCCGCAGGATGA No data
Right 920751334 1:208680239-208680261 ATGAGGGAGTATAAAGAAAATGG No data
920751330_920751335 -3 Left 920751330 1:208680220-208680242 CCTGGGCAAGCTCCGCAGGATGA No data
Right 920751335 1:208680240-208680262 TGAGGGAGTATAAAGAAAATGGG No data
920751330_920751337 27 Left 920751330 1:208680220-208680242 CCTGGGCAAGCTCCGCAGGATGA No data
Right 920751337 1:208680270-208680292 GCTGTTGTAAACCCAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920751330 Original CRISPR TCATCCTGCGGAGCTTGCCC AGG (reversed) Intergenic