ID: 920752931

View in Genome Browser
Species Human (GRCh38)
Location 1:208698616-208698638
Sequence GTTTTTAAAAGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920752931_920752935 -2 Left 920752931 1:208698616-208698638 CCCTCCATGATCCTTTTAAAAAC No data
Right 920752935 1:208698637-208698659 ACTCCAGCCCAGAAATCCTCAGG No data
920752931_920752940 13 Left 920752931 1:208698616-208698638 CCCTCCATGATCCTTTTAAAAAC No data
Right 920752940 1:208698652-208698674 TCCTCAGGGAGCTGATTTAACGG No data
920752931_920752936 -1 Left 920752931 1:208698616-208698638 CCCTCCATGATCCTTTTAAAAAC No data
Right 920752936 1:208698638-208698660 CTCCAGCCCAGAAATCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920752931 Original CRISPR GTTTTTAAAAGGATCATGGA GGG (reversed) Intergenic
No off target data available for this crispr