ID: 920758715

View in Genome Browser
Species Human (GRCh38)
Location 1:208761085-208761107
Sequence TTTAACCTGCTCACCAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920758715_920758720 -7 Left 920758715 1:208761085-208761107 CCTATCCTGGTGAGCAGGTTAAA No data
Right 920758720 1:208761101-208761123 GGTTAAAAGGGTAAGGAGCTTGG No data
920758715_920758721 5 Left 920758715 1:208761085-208761107 CCTATCCTGGTGAGCAGGTTAAA No data
Right 920758721 1:208761113-208761135 AAGGAGCTTGGCAAGAGAAATGG No data
920758715_920758722 6 Left 920758715 1:208761085-208761107 CCTATCCTGGTGAGCAGGTTAAA No data
Right 920758722 1:208761114-208761136 AGGAGCTTGGCAAGAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920758715 Original CRISPR TTTAACCTGCTCACCAGGAT AGG (reversed) Intergenic
No off target data available for this crispr