ID: 920760346

View in Genome Browser
Species Human (GRCh38)
Location 1:208777852-208777874
Sequence GAACCAAGGCTAGTTTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920760340_920760346 11 Left 920760340 1:208777818-208777840 CCGTTCTTTTGGAGGAGTTTACA No data
Right 920760346 1:208777852-208777874 GAACCAAGGCTAGTTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920760346 Original CRISPR GAACCAAGGCTAGTTTCCAC AGG Intergenic
No off target data available for this crispr