ID: 920760807

View in Genome Browser
Species Human (GRCh38)
Location 1:208782096-208782118
Sequence GATGCTGGTGCTGGCCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920760793_920760807 22 Left 920760793 1:208782051-208782073 CCCCACTGAATAGAAGTGAAAGG No data
Right 920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG No data
920760792_920760807 25 Left 920760792 1:208782048-208782070 CCACCCCACTGAATAGAAGTGAA No data
Right 920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG No data
920760797_920760807 20 Left 920760797 1:208782053-208782075 CCACTGAATAGAAGTGAAAGGGG No data
Right 920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG No data
920760795_920760807 21 Left 920760795 1:208782052-208782074 CCCACTGAATAGAAGTGAAAGGG No data
Right 920760807 1:208782096-208782118 GATGCTGGTGCTGGCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920760807 Original CRISPR GATGCTGGTGCTGGCCATGA TGG Intergenic
No off target data available for this crispr