ID: 920761498

View in Genome Browser
Species Human (GRCh38)
Location 1:208787413-208787435
Sequence CCAGCTCCACACACCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920761491_920761498 28 Left 920761491 1:208787362-208787384 CCTCCTCCTTTCTCATCAAATCA No data
Right 920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG No data
920761492_920761498 25 Left 920761492 1:208787365-208787387 CCTCCTTTCTCATCAAATCACTC No data
Right 920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG No data
920761493_920761498 22 Left 920761493 1:208787368-208787390 CCTTTCTCATCAAATCACTCATA No data
Right 920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920761498 Original CRISPR CCAGCTCCACACACCCATCA GGG Intergenic
No off target data available for this crispr