ID: 920762161

View in Genome Browser
Species Human (GRCh38)
Location 1:208795063-208795085
Sequence ATAAGCATGTTCATCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920762158_920762161 24 Left 920762158 1:208795016-208795038 CCTTAAAGGATATCAAAAGTGTA No data
Right 920762161 1:208795063-208795085 ATAAGCATGTTCATCCATGAAGG No data
920762160_920762161 -1 Left 920762160 1:208795041-208795063 CCAAGAGTCTCATATCTAGGAAA No data
Right 920762161 1:208795063-208795085 ATAAGCATGTTCATCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920762161 Original CRISPR ATAAGCATGTTCATCCATGA AGG Intergenic
No off target data available for this crispr