ID: 920766600

View in Genome Browser
Species Human (GRCh38)
Location 1:208839650-208839672
Sequence AACTGCTTGGAGAATACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920766600_920766603 -10 Left 920766600 1:208839650-208839672 CCCTGAGTATTCTCCAAGCAGTT No data
Right 920766603 1:208839663-208839685 CCAAGCAGTTTTCTCTAGAAAGG No data
920766600_920766604 -9 Left 920766600 1:208839650-208839672 CCCTGAGTATTCTCCAAGCAGTT No data
Right 920766604 1:208839664-208839686 CAAGCAGTTTTCTCTAGAAAGGG No data
920766600_920766605 12 Left 920766600 1:208839650-208839672 CCCTGAGTATTCTCCAAGCAGTT No data
Right 920766605 1:208839685-208839707 GGAAAGACCATGTTGTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920766600 Original CRISPR AACTGCTTGGAGAATACTCA GGG (reversed) Intergenic
No off target data available for this crispr