ID: 920769062

View in Genome Browser
Species Human (GRCh38)
Location 1:208863355-208863377
Sequence CCGAAGCACCATGTATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920769062_920769067 15 Left 920769062 1:208863355-208863377 CCAGCAGATACATGGTGCTTCGG No data
Right 920769067 1:208863393-208863415 AAAGGCAATAGTGTAAATATAGG No data
920769062_920769064 -3 Left 920769062 1:208863355-208863377 CCAGCAGATACATGGTGCTTCGG No data
Right 920769064 1:208863375-208863397 CGGACCACGAGCCTGATTAAAGG No data
920769062_920769068 20 Left 920769062 1:208863355-208863377 CCAGCAGATACATGGTGCTTCGG No data
Right 920769068 1:208863398-208863420 CAATAGTGTAAATATAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920769062 Original CRISPR CCGAAGCACCATGTATCTGC TGG (reversed) Intergenic
No off target data available for this crispr