ID: 920776054

View in Genome Browser
Species Human (GRCh38)
Location 1:208938324-208938346
Sequence AGAAAGCCTAAACATGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776054_920776061 16 Left 920776054 1:208938324-208938346 CCATAGCCATGTTTAGGCTTTCT No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data
920776054_920776065 28 Left 920776054 1:208938324-208938346 CCATAGCCATGTTTAGGCTTTCT No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776054_920776060 15 Left 920776054 1:208938324-208938346 CCATAGCCATGTTTAGGCTTTCT No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776054 Original CRISPR AGAAAGCCTAAACATGGCTA TGG (reversed) Intergenic
No off target data available for this crispr