ID: 920776056

View in Genome Browser
Species Human (GRCh38)
Location 1:208938347-208938369
Sequence GAGGATGAGATGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776056_920776065 5 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776056_920776060 -8 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776056_920776066 30 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776056_920776061 -7 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776056 Original CRISPR GAGGATGAGATGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr