ID: 920776057

View in Genome Browser
Species Human (GRCh38)
Location 1:208938348-208938370
Sequence TGAGGATGAGATGAAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776057_920776066 29 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776057_920776060 -9 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776057_920776061 -8 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data
920776057_920776065 4 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776057 Original CRISPR TGAGGATGAGATGAAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr