ID: 920776059

View in Genome Browser
Species Human (GRCh38)
Location 1:208938354-208938376
Sequence GGGAACTGAGGATGAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776059_920776065 -2 Left 920776059 1:208938354-208938376 CCTTCATCTCATCCTCAGTTCCC No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776059_920776066 23 Left 920776059 1:208938354-208938376 CCTTCATCTCATCCTCAGTTCCC No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776059 Original CRISPR GGGAACTGAGGATGAGATGA AGG (reversed) Intergenic
No off target data available for this crispr