ID: 920776060

View in Genome Browser
Species Human (GRCh38)
Location 1:208938362-208938384
Sequence TCATCCTCAGTTCCCATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776056_920776060 -8 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776055_920776060 9 Left 920776055 1:208938330-208938352 CCATGTTTAGGCTTTCTCCCTCC No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776051_920776060 30 Left 920776051 1:208938309-208938331 CCAAAAGGCCAATGGCCATAGCC No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776052_920776060 22 Left 920776052 1:208938317-208938339 CCAATGGCCATAGCCATGTTTAG No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776057_920776060 -9 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data
920776054_920776060 15 Left 920776054 1:208938324-208938346 CCATAGCCATGTTTAGGCTTTCT No data
Right 920776060 1:208938362-208938384 TCATCCTCAGTTCCCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776060 Original CRISPR TCATCCTCAGTTCCCATTTG TGG Intergenic
No off target data available for this crispr