ID: 920776061

View in Genome Browser
Species Human (GRCh38)
Location 1:208938363-208938385
Sequence CATCCTCAGTTCCCATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776056_920776061 -7 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data
920776052_920776061 23 Left 920776052 1:208938317-208938339 CCAATGGCCATAGCCATGTTTAG No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data
920776055_920776061 10 Left 920776055 1:208938330-208938352 CCATGTTTAGGCTTTCTCCCTCC No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data
920776054_920776061 16 Left 920776054 1:208938324-208938346 CCATAGCCATGTTTAGGCTTTCT No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data
920776057_920776061 -8 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776061 1:208938363-208938385 CATCCTCAGTTCCCATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776061 Original CRISPR CATCCTCAGTTCCCATTTGT GGG Intergenic
No off target data available for this crispr