ID: 920776065

View in Genome Browser
Species Human (GRCh38)
Location 1:208938375-208938397
Sequence CCATTTGTGGGTGACTTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776055_920776065 22 Left 920776055 1:208938330-208938352 CCATGTTTAGGCTTTCTCCCTCC No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776054_920776065 28 Left 920776054 1:208938324-208938346 CCATAGCCATGTTTAGGCTTTCT No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776056_920776065 5 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776057_920776065 4 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776058_920776065 1 Left 920776058 1:208938351-208938373 CCTCCTTCATCTCATCCTCAGTT No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
920776059_920776065 -2 Left 920776059 1:208938354-208938376 CCTTCATCTCATCCTCAGTTCCC No data
Right 920776065 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776065 Original CRISPR CCATTTGTGGGTGACTTACT AGG Intergenic
No off target data available for this crispr