ID: 920776066

View in Genome Browser
Species Human (GRCh38)
Location 1:208938400-208938422
Sequence TTGCAAAAAGTTCCCATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776062_920776066 11 Left 920776062 1:208938366-208938388 CCTCAGTTCCCATTTGTGGGTGA No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776059_920776066 23 Left 920776059 1:208938354-208938376 CCTTCATCTCATCCTCAGTTCCC No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776058_920776066 26 Left 920776058 1:208938351-208938373 CCTCCTTCATCTCATCCTCAGTT No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776063_920776066 3 Left 920776063 1:208938374-208938396 CCCATTTGTGGGTGACTTACTAG No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776056_920776066 30 Left 920776056 1:208938347-208938369 CCCTCCTCCTTCATCTCATCCTC No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776064_920776066 2 Left 920776064 1:208938375-208938397 CCATTTGTGGGTGACTTACTAGG No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data
920776057_920776066 29 Left 920776057 1:208938348-208938370 CCTCCTCCTTCATCTCATCCTCA No data
Right 920776066 1:208938400-208938422 TTGCAAAAAGTTCCCATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776066 Original CRISPR TTGCAAAAAGTTCCCATTTG TGG Intergenic
No off target data available for this crispr