ID: 920776433

View in Genome Browser
Species Human (GRCh38)
Location 1:208942634-208942656
Sequence TATGAGCCTGAATATGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920776433_920776436 10 Left 920776433 1:208942634-208942656 CCATGGACATATTCAGGCTCATA No data
Right 920776436 1:208942667-208942689 TAAAGTTGCACTTGTAGGCTGGG No data
920776433_920776437 21 Left 920776433 1:208942634-208942656 CCATGGACATATTCAGGCTCATA No data
Right 920776437 1:208942678-208942700 TTGTAGGCTGGGTAAACAAATGG No data
920776433_920776435 9 Left 920776433 1:208942634-208942656 CCATGGACATATTCAGGCTCATA No data
Right 920776435 1:208942666-208942688 ATAAAGTTGCACTTGTAGGCTGG No data
920776433_920776434 5 Left 920776433 1:208942634-208942656 CCATGGACATATTCAGGCTCATA No data
Right 920776434 1:208942662-208942684 AATAATAAAGTTGCACTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920776433 Original CRISPR TATGAGCCTGAATATGTCCA TGG (reversed) Intergenic
No off target data available for this crispr