ID: 920779651

View in Genome Browser
Species Human (GRCh38)
Location 1:208976243-208976265
Sequence CTCTTAATGGAAGGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920779651_920779658 14 Left 920779651 1:208976243-208976265 CCTGACACACCTTCCATTAAGAG No data
Right 920779658 1:208976280-208976302 CTCTTCCTTGGACTCTAGCTGGG No data
920779651_920779657 13 Left 920779651 1:208976243-208976265 CCTGACACACCTTCCATTAAGAG No data
Right 920779657 1:208976279-208976301 CCTCTTCCTTGGACTCTAGCTGG No data
920779651_920779655 2 Left 920779651 1:208976243-208976265 CCTGACACACCTTCCATTAAGAG No data
Right 920779655 1:208976268-208976290 AGGATCTATGTCCTCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920779651 Original CRISPR CTCTTAATGGAAGGTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr