ID: 920779657

View in Genome Browser
Species Human (GRCh38)
Location 1:208976279-208976301
Sequence CCTCTTCCTTGGACTCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920779654_920779657 0 Left 920779654 1:208976256-208976278 CCATTAAGAGATAGGATCTATGT No data
Right 920779657 1:208976279-208976301 CCTCTTCCTTGGACTCTAGCTGG No data
920779651_920779657 13 Left 920779651 1:208976243-208976265 CCTGACACACCTTCCATTAAGAG No data
Right 920779657 1:208976279-208976301 CCTCTTCCTTGGACTCTAGCTGG No data
920779653_920779657 4 Left 920779653 1:208976252-208976274 CCTTCCATTAAGAGATAGGATCT No data
Right 920779657 1:208976279-208976301 CCTCTTCCTTGGACTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920779657 Original CRISPR CCTCTTCCTTGGACTCTAGC TGG Intergenic
No off target data available for this crispr