ID: 920779658

View in Genome Browser
Species Human (GRCh38)
Location 1:208976280-208976302
Sequence CTCTTCCTTGGACTCTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920779653_920779658 5 Left 920779653 1:208976252-208976274 CCTTCCATTAAGAGATAGGATCT No data
Right 920779658 1:208976280-208976302 CTCTTCCTTGGACTCTAGCTGGG No data
920779651_920779658 14 Left 920779651 1:208976243-208976265 CCTGACACACCTTCCATTAAGAG No data
Right 920779658 1:208976280-208976302 CTCTTCCTTGGACTCTAGCTGGG No data
920779654_920779658 1 Left 920779654 1:208976256-208976278 CCATTAAGAGATAGGATCTATGT No data
Right 920779658 1:208976280-208976302 CTCTTCCTTGGACTCTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920779658 Original CRISPR CTCTTCCTTGGACTCTAGCT GGG Intergenic
No off target data available for this crispr