ID: 920781714

View in Genome Browser
Species Human (GRCh38)
Location 1:208998118-208998140
Sequence CAACTTCCTGTAGCATATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920781710_920781714 -5 Left 920781710 1:208998100-208998122 CCTACTCCCTCTAGAGGTCAACT No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data
920781706_920781714 1 Left 920781706 1:208998094-208998116 CCATCCCCTACTCCCTCTAGAGG No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data
920781708_920781714 -3 Left 920781708 1:208998098-208998120 CCCCTACTCCCTCTAGAGGTCAA No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data
920781704_920781714 3 Left 920781704 1:208998092-208998114 CCCCATCCCCTACTCCCTCTAGA No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data
920781705_920781714 2 Left 920781705 1:208998093-208998115 CCCATCCCCTACTCCCTCTAGAG No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data
920781703_920781714 4 Left 920781703 1:208998091-208998113 CCCCCATCCCCTACTCCCTCTAG No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data
920781709_920781714 -4 Left 920781709 1:208998099-208998121 CCCTACTCCCTCTAGAGGTCAAC No data
Right 920781714 1:208998118-208998140 CAACTTCCTGTAGCATATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920781714 Original CRISPR CAACTTCCTGTAGCATATTT GGG Intergenic
No off target data available for this crispr