ID: 920784776

View in Genome Browser
Species Human (GRCh38)
Location 1:209030680-209030702
Sequence GAGGGCACGCACAGGCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920784773_920784776 -9 Left 920784773 1:209030666-209030688 CCAGCACGTGGACCGAGGGCACG No data
Right 920784776 1:209030680-209030702 GAGGGCACGCACAGGCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920784776 Original CRISPR GAGGGCACGCACAGGCCCAC TGG Intergenic