ID: 920785123

View in Genome Browser
Species Human (GRCh38)
Location 1:209033943-209033965
Sequence TCTTATCTTTTAAAGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920785123_920785126 18 Left 920785123 1:209033943-209033965 CCACACACCTTTAAAAGATAAGA No data
Right 920785126 1:209033984-209034006 GGAGTCTCGCTCTTTCGCCCAGG 0: 498
1: 22349
2: 61874
3: 119923
4: 145507
920785123_920785127 22 Left 920785123 1:209033943-209033965 CCACACACCTTTAAAAGATAAGA No data
Right 920785127 1:209033988-209034010 TCTCGCTCTTTCGCCCAGGCTGG 0: 650
1: 29455
2: 96773
3: 202196
4: 198673
920785123_920785125 -3 Left 920785123 1:209033943-209033965 CCACACACCTTTAAAAGATAAGA No data
Right 920785125 1:209033963-209033985 AGATCTTTTTTTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920785123 Original CRISPR TCTTATCTTTTAAAGGTGTG TGG (reversed) Intergenic
No off target data available for this crispr