ID: 920795284

View in Genome Browser
Species Human (GRCh38)
Location 1:209131047-209131069
Sequence CTAGTTTTCCAGGTTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920795284_920795292 11 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795292 1:209131081-209131103 ACACTATGCCGACGGGGGTCGGG No data
920795284_920795290 6 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795290 1:209131076-209131098 AGTTCACACTATGCCGACGGGGG No data
920795284_920795299 24 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795299 1:209131094-209131116 GGGGGTCGGGGCGGGGGCAGCGG No data
920795284_920795300 27 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795300 1:209131097-209131119 GGTCGGGGCGGGGGCAGCGGTGG No data
920795284_920795291 10 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795291 1:209131080-209131102 CACACTATGCCGACGGGGGTCGG No data
920795284_920795293 12 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795293 1:209131082-209131104 CACTATGCCGACGGGGGTCGGGG No data
920795284_920795294 15 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795294 1:209131085-209131107 TATGCCGACGGGGGTCGGGGCGG No data
920795284_920795289 5 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795289 1:209131075-209131097 TAGTTCACACTATGCCGACGGGG No data
920795284_920795288 4 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795288 1:209131074-209131096 CTAGTTCACACTATGCCGACGGG No data
920795284_920795297 18 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795297 1:209131088-209131110 GCCGACGGGGGTCGGGGCGGGGG No data
920795284_920795295 16 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795295 1:209131086-209131108 ATGCCGACGGGGGTCGGGGCGGG No data
920795284_920795287 3 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795287 1:209131073-209131095 ACTAGTTCACACTATGCCGACGG No data
920795284_920795301 30 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795301 1:209131100-209131122 CGGGGCGGGGGCAGCGGTGGTGG No data
920795284_920795296 17 Left 920795284 1:209131047-209131069 CCCAAGGAAACCTGGAAAACTAG No data
Right 920795296 1:209131087-209131109 TGCCGACGGGGGTCGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920795284 Original CRISPR CTAGTTTTCCAGGTTTCCTT GGG (reversed) Intergenic
No off target data available for this crispr