ID: 920796758

View in Genome Browser
Species Human (GRCh38)
Location 1:209145237-209145259
Sequence GAATGACATGATTAGGTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920796755_920796758 16 Left 920796755 1:209145198-209145220 CCAATAGATACATGTAAAGACTG No data
Right 920796758 1:209145237-209145259 GAATGACATGATTAGGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920796758 Original CRISPR GAATGACATGATTAGGTTAA AGG Intergenic
No off target data available for this crispr