ID: 920801406

View in Genome Browser
Species Human (GRCh38)
Location 1:209191145-209191167
Sequence ACTATGGCAGAGCCATGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920801404_920801406 11 Left 920801404 1:209191111-209191133 CCAGGGTGCAGAGGCTAAACAGA No data
Right 920801406 1:209191145-209191167 ACTATGGCAGAGCCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920801406 Original CRISPR ACTATGGCAGAGCCATGTTG AGG Intergenic
No off target data available for this crispr