ID: 920801553

View in Genome Browser
Species Human (GRCh38)
Location 1:209192861-209192883
Sequence CAGTTAAACAGAAAGCGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920801553_920801556 22 Left 920801553 1:209192861-209192883 CCAGTACGCTTTCTGTTTAACTG No data
Right 920801556 1:209192906-209192928 CCCAGCAAGGAGAAATTTGCAGG No data
920801553_920801554 9 Left 920801553 1:209192861-209192883 CCAGTACGCTTTCTGTTTAACTG No data
Right 920801554 1:209192893-209192915 TGAAATCTCTGTTCCCAGCAAGG No data
920801553_920801558 26 Left 920801553 1:209192861-209192883 CCAGTACGCTTTCTGTTTAACTG No data
Right 920801558 1:209192910-209192932 GCAAGGAGAAATTTGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920801553 Original CRISPR CAGTTAAACAGAAAGCGTAC TGG (reversed) Intergenic
No off target data available for this crispr