ID: 920801556

View in Genome Browser
Species Human (GRCh38)
Location 1:209192906-209192928
Sequence CCCAGCAAGGAGAAATTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920801553_920801556 22 Left 920801553 1:209192861-209192883 CCAGTACGCTTTCTGTTTAACTG No data
Right 920801556 1:209192906-209192928 CCCAGCAAGGAGAAATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920801556 Original CRISPR CCCAGCAAGGAGAAATTTGC AGG Intergenic
No off target data available for this crispr