ID: 920805720

View in Genome Browser
Species Human (GRCh38)
Location 1:209231858-209231880
Sequence CCGTGCCCCGCGCCGGATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920805712_920805720 -2 Left 920805712 1:209231837-209231859 CCTCCCGGCTGACAGCAGCGCCC No data
Right 920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG No data
920805706_920805720 25 Left 920805706 1:209231810-209231832 CCGCGGGGCCGGGGTCGCGGGCT No data
Right 920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG No data
920805711_920805720 -1 Left 920805711 1:209231836-209231858 CCCTCCCGGCTGACAGCAGCGCC No data
Right 920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG No data
920805713_920805720 -5 Left 920805713 1:209231840-209231862 CCCGGCTGACAGCAGCGCCCGTG No data
Right 920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG No data
920805714_920805720 -6 Left 920805714 1:209231841-209231863 CCGGCTGACAGCAGCGCCCGTGC No data
Right 920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG No data
920805709_920805720 17 Left 920805709 1:209231818-209231840 CCGGGGTCGCGGGCTGGGCCCTC No data
Right 920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920805720 Original CRISPR CCGTGCCCCGCGCCGGATTG GGG Intergenic
No off target data available for this crispr