ID: 920807074

View in Genome Browser
Species Human (GRCh38)
Location 1:209245048-209245070
Sequence ATTAGGTTATTCCAGTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807074_920807077 -3 Left 920807074 1:209245048-209245070 CCTAGACACTGGAATAACCTAAT No data
Right 920807077 1:209245068-209245090 AATGCCCATAAAAGAGGTAATGG No data
920807074_920807080 9 Left 920807074 1:209245048-209245070 CCTAGACACTGGAATAACCTAAT No data
Right 920807080 1:209245080-209245102 AGAGGTAATGGTTAAATAAGTGG No data
920807074_920807075 -9 Left 920807074 1:209245048-209245070 CCTAGACACTGGAATAACCTAAT No data
Right 920807075 1:209245062-209245084 TAACCTAATGCCCATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920807074 Original CRISPR ATTAGGTTATTCCAGTGTCT AGG (reversed) Intergenic
No off target data available for this crispr