ID: 920807201

View in Genome Browser
Species Human (GRCh38)
Location 1:209246010-209246032
Sequence TCCCTGTTCCTCGGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807201_920807210 24 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807210 1:209246057-209246079 TAGGCCATAGTTGGACATCTGGG No data
920807201_920807211 27 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807211 1:209246060-209246082 GCCATAGTTGGACATCTGGGTGG No data
920807201_920807209 23 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807201_920807208 15 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807201_920807206 5 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807206 1:209246038-209246060 ACCTCAGAATGTAGCGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920807201 Original CRISPR TCCCTGTTCCTCGGGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr