ID: 920807203

View in Genome Browser
Species Human (GRCh38)
Location 1:209246017-209246039
Sequence GTACCACTCCCTGTTCCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807203_920807206 -2 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807206 1:209246038-209246060 ACCTCAGAATGTAGCGTTCTAGG No data
920807203_920807211 20 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807211 1:209246060-209246082 GCCATAGTTGGACATCTGGGTGG No data
920807203_920807210 17 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807210 1:209246057-209246079 TAGGCCATAGTTGGACATCTGGG No data
920807203_920807208 8 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807203_920807209 16 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920807203 Original CRISPR GTACCACTCCCTGTTCCTCG GGG (reversed) Intergenic