ID: 920807204

View in Genome Browser
Species Human (GRCh38)
Location 1:209246018-209246040
Sequence GGTACCACTCCCTGTTCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807204_920807209 15 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807204_920807206 -3 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807206 1:209246038-209246060 ACCTCAGAATGTAGCGTTCTAGG No data
920807204_920807208 7 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807204_920807211 19 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807211 1:209246060-209246082 GCCATAGTTGGACATCTGGGTGG No data
920807204_920807210 16 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807210 1:209246057-209246079 TAGGCCATAGTTGGACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920807204 Original CRISPR GGTACCACTCCCTGTTCCTC GGG (reversed) Intergenic