ID: 920807207

View in Genome Browser
Species Human (GRCh38)
Location 1:209246039-209246061
Sequence GCCTAGAACGCTACATTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807207_920807211 -2 Left 920807207 1:209246039-209246061 CCTCAGAATGTAGCGTTCTAGGC No data
Right 920807211 1:209246060-209246082 GCCATAGTTGGACATCTGGGTGG No data
920807207_920807214 29 Left 920807207 1:209246039-209246061 CCTCAGAATGTAGCGTTCTAGGC No data
Right 920807214 1:209246091-209246113 AGTTGTTGAGTTGCATGCAGAGG No data
920807207_920807209 -6 Left 920807207 1:209246039-209246061 CCTCAGAATGTAGCGTTCTAGGC No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807207_920807210 -5 Left 920807207 1:209246039-209246061 CCTCAGAATGTAGCGTTCTAGGC No data
Right 920807210 1:209246057-209246079 TAGGCCATAGTTGGACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920807207 Original CRISPR GCCTAGAACGCTACATTCTG AGG (reversed) Intergenic