ID: 920807208

View in Genome Browser
Species Human (GRCh38)
Location 1:209246048-209246070
Sequence GTAGCGTTCTAGGCCATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807203_920807208 8 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807196_920807208 24 Left 920807196 1:209246001-209246023 CCGTCTAGCCCAGGAGCCCCGAG No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807201_920807208 15 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807199_920807208 16 Left 920807199 1:209246009-209246031 CCCAGGAGCCCCGAGGAACAGGG No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807205_920807208 6 Left 920807205 1:209246019-209246041 CCGAGGAACAGGGAGTGGTACCT No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data
920807204_920807208 7 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807208 1:209246048-209246070 GTAGCGTTCTAGGCCATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920807208 Original CRISPR GTAGCGTTCTAGGCCATAGT TGG Intergenic