ID: 920807209

View in Genome Browser
Species Human (GRCh38)
Location 1:209246056-209246078
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920807199_920807209 24 Left 920807199 1:209246009-209246031 CCCAGGAGCCCCGAGGAACAGGG No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807207_920807209 -6 Left 920807207 1:209246039-209246061 CCTCAGAATGTAGCGTTCTAGGC No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807204_920807209 15 Left 920807204 1:209246018-209246040 CCCGAGGAACAGGGAGTGGTACC No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807205_920807209 14 Left 920807205 1:209246019-209246041 CCGAGGAACAGGGAGTGGTACCT No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807203_920807209 16 Left 920807203 1:209246017-209246039 CCCCGAGGAACAGGGAGTGGTAC No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data
920807201_920807209 23 Left 920807201 1:209246010-209246032 CCAGGAGCCCCGAGGAACAGGGA No data
Right 920807209 1:209246056-209246078 CTAGGCCATAGTTGGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type