ID: 920811706

View in Genome Browser
Species Human (GRCh38)
Location 1:209291986-209292008
Sequence AGCCCCGTGCTGTGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920811699_920811706 9 Left 920811699 1:209291954-209291976 CCACCATGTGGAGGAGTGAGCAG No data
Right 920811706 1:209291986-209292008 AGCCCCGTGCTGTGGGAAACAGG No data
920811700_920811706 6 Left 920811700 1:209291957-209291979 CCATGTGGAGGAGTGAGCAGCAA No data
Right 920811706 1:209291986-209292008 AGCCCCGTGCTGTGGGAAACAGG No data
920811696_920811706 27 Left 920811696 1:209291936-209291958 CCTTCATCAAACACAGGACCACC No data
Right 920811706 1:209291986-209292008 AGCCCCGTGCTGTGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920811706 Original CRISPR AGCCCCGTGCTGTGGGAAAC AGG Intergenic
No off target data available for this crispr