ID: 920811719

View in Genome Browser
Species Human (GRCh38)
Location 1:209292068-209292090
Sequence CCCCATGAAAATGGAGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920811713_920811719 12 Left 920811713 1:209292033-209292055 CCAATTGGCTTTGTGGTTGTAGG No data
Right 920811719 1:209292068-209292090 CCCCATGAAAATGGAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920811719 Original CRISPR CCCCATGAAAATGGAGACCA AGG Intergenic
No off target data available for this crispr