ID: 920812951

View in Genome Browser
Species Human (GRCh38)
Location 1:209304216-209304238
Sequence CCTACCTTCTCCAATGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920812951_920812955 17 Left 920812951 1:209304216-209304238 CCAGTTCCATTGGAGAAGGTAGG No data
Right 920812955 1:209304256-209304278 ACAATATAATTTGTACAGCAGGG No data
920812951_920812954 16 Left 920812951 1:209304216-209304238 CCAGTTCCATTGGAGAAGGTAGG No data
Right 920812954 1:209304255-209304277 TACAATATAATTTGTACAGCAGG No data
920812951_920812956 18 Left 920812951 1:209304216-209304238 CCAGTTCCATTGGAGAAGGTAGG No data
Right 920812956 1:209304257-209304279 CAATATAATTTGTACAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920812951 Original CRISPR CCTACCTTCTCCAATGGAAC TGG (reversed) Intergenic
No off target data available for this crispr