ID: 920813751

View in Genome Browser
Species Human (GRCh38)
Location 1:209311447-209311469
Sequence CATACTTTGCAGGGCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920813746_920813751 15 Left 920813746 1:209311409-209311431 CCATGAAATGCTATGCAGCCATA 0: 16
1: 898
2: 25831
3: 13990
4: 8173
Right 920813751 1:209311447-209311469 CATACTTTGCAGGGCATGGATGG No data
920813747_920813751 -3 Left 920813747 1:209311427-209311449 CCATAAAAAGAAAGAGAACACAT No data
Right 920813751 1:209311447-209311469 CATACTTTGCAGGGCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920813751 Original CRISPR CATACTTTGCAGGGCATGGA TGG Intergenic
No off target data available for this crispr