ID: 920816000

View in Genome Browser
Species Human (GRCh38)
Location 1:209332631-209332653
Sequence GTGTTGGTAAGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920816000_920816005 -2 Left 920816000 1:209332631-209332653 CCTTCTGCCCTCCTTACCAACAC No data
Right 920816005 1:209332652-209332674 ACCAAGCTGCAAGTGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920816000 Original CRISPR GTGTTGGTAAGGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr