ID: 920822427

View in Genome Browser
Species Human (GRCh38)
Location 1:209393443-209393465
Sequence GGTTATTTGCAGACAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920822422_920822427 26 Left 920822422 1:209393394-209393416 CCTTGAACACATTTTGGAACAAA No data
Right 920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG No data
920822424_920822427 -5 Left 920822424 1:209393425-209393447 CCAAGAAAAGAAGAACATGGTTA No data
Right 920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920822427 Original CRISPR GGTTATTTGCAGACAATGGA GGG Intergenic
No off target data available for this crispr