ID: 920822427 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:209393443-209393465 |
| Sequence | GGTTATTTGCAGACAATGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920822422_920822427 | 26 | Left | 920822422 | 1:209393394-209393416 | CCTTGAACACATTTTGGAACAAA | No data | ||
| Right | 920822427 | 1:209393443-209393465 | GGTTATTTGCAGACAATGGAGGG | No data | ||||
| 920822424_920822427 | -5 | Left | 920822424 | 1:209393425-209393447 | CCAAGAAAAGAAGAACATGGTTA | No data | ||
| Right | 920822427 | 1:209393443-209393465 | GGTTATTTGCAGACAATGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920822427 | Original CRISPR | GGTTATTTGCAGACAATGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||