ID: 920825874

View in Genome Browser
Species Human (GRCh38)
Location 1:209423856-209423878
Sequence CTGGGTGAGGGGGAGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920825858_920825874 16 Left 920825858 1:209423817-209423839 CCCTGGGGTTTTTTCCTCACTTG No data
Right 920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG No data
920825862_920825874 2 Left 920825862 1:209423831-209423853 CCTCACTTGAAGGACTAGGTTAG No data
Right 920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG No data
920825859_920825874 15 Left 920825859 1:209423818-209423840 CCTGGGGTTTTTTCCTCACTTGA No data
Right 920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920825874 Original CRISPR CTGGGTGAGGGGGAGGTGTG GGG Intergenic
No off target data available for this crispr