ID: 920826102

View in Genome Browser
Species Human (GRCh38)
Location 1:209425542-209425564
Sequence GTCCATGACCATAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920826102_920826109 3 Left 920826102 1:209425542-209425564 CCATCCCCATTATGGTCATGGAC No data
Right 920826109 1:209425568-209425590 GATGTCCCCAGCAGCTTCCTGGG No data
920826102_920826108 2 Left 920826102 1:209425542-209425564 CCATCCCCATTATGGTCATGGAC No data
Right 920826108 1:209425567-209425589 TGATGTCCCCAGCAGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920826102 Original CRISPR GTCCATGACCATAATGGGGA TGG (reversed) Intergenic
No off target data available for this crispr