ID: 920826102 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:209425542-209425564 |
Sequence | GTCCATGACCATAATGGGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
920826102_920826109 | 3 | Left | 920826102 | 1:209425542-209425564 | CCATCCCCATTATGGTCATGGAC | No data | ||
Right | 920826109 | 1:209425568-209425590 | GATGTCCCCAGCAGCTTCCTGGG | No data | ||||
920826102_920826108 | 2 | Left | 920826102 | 1:209425542-209425564 | CCATCCCCATTATGGTCATGGAC | No data | ||
Right | 920826108 | 1:209425567-209425589 | TGATGTCCCCAGCAGCTTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
920826102 | Original CRISPR | GTCCATGACCATAATGGGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |