ID: 920828696

View in Genome Browser
Species Human (GRCh38)
Location 1:209446377-209446399
Sequence TAGTGCCATCTCAGGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920828696_920828700 -5 Left 920828696 1:209446377-209446399 CCACATCCCCTGAGATGGCACTA No data
Right 920828700 1:209446395-209446417 CACTACTGTGTGCCTTGAGTAGG No data
920828696_920828703 30 Left 920828696 1:209446377-209446399 CCACATCCCCTGAGATGGCACTA No data
Right 920828703 1:209446430-209446452 TCTATCAGGCCAGCATTTTTAGG No data
920828696_920828702 16 Left 920828696 1:209446377-209446399 CCACATCCCCTGAGATGGCACTA No data
Right 920828702 1:209446416-209446438 GGTTATTGCATCACTCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920828696 Original CRISPR TAGTGCCATCTCAGGGGATG TGG (reversed) Intergenic
No off target data available for this crispr