ID: 920830057

View in Genome Browser
Species Human (GRCh38)
Location 1:209456425-209456447
Sequence ATGTGGTTTGGTATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920830057_920830061 -1 Left 920830057 1:209456425-209456447 CCATGTTCCATACCAAACCACAT No data
Right 920830061 1:209456447-209456469 TTCACAGCTTACTGCTATTGTGG No data
920830057_920830062 14 Left 920830057 1:209456425-209456447 CCATGTTCCATACCAAACCACAT No data
Right 920830062 1:209456462-209456484 TATTGTGGTTCTAGATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920830057 Original CRISPR ATGTGGTTTGGTATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr