ID: 920833685

View in Genome Browser
Species Human (GRCh38)
Location 1:209488159-209488181
Sequence CACTACAGAGAAGGGATCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920833676_920833685 28 Left 920833676 1:209488108-209488130 CCAAACAGAATCCAATCCTAGTC No data
Right 920833685 1:209488159-209488181 CACTACAGAGAAGGGATCTTTGG No data
920833677_920833685 17 Left 920833677 1:209488119-209488141 CCAATCCTAGTCAAATCTTCAGC No data
Right 920833685 1:209488159-209488181 CACTACAGAGAAGGGATCTTTGG No data
920833678_920833685 12 Left 920833678 1:209488124-209488146 CCTAGTCAAATCTTCAGCTAGAA No data
Right 920833685 1:209488159-209488181 CACTACAGAGAAGGGATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920833685 Original CRISPR CACTACAGAGAAGGGATCTT TGG Intergenic
No off target data available for this crispr